Table 8 Characteristics of the eight EST-SSRs selected and their putative functions
Locus | Primer sequence (5′–3′) | Repeat motif | Expected size (bp) | Putative function (protein)/gene | Reported function, notes | References |
|---|---|---|---|---|---|---|
FIR059 | F: GGTGGTTTCCGTGAGCATAG R: TTGCCACACCTTCTCGTTAG | GA | 157–169 | DEAD-box ATP-dependent RNA helicase 7/RH7 | Implicated to have a function during stress adaptation processes including (salt or) drought stress | Kim et al. 2008 |
FIR080 | F: ACCATACCTGGCTTCGATGA R: AAGGTGAGTTGGTGGTGGAG | ACC | 207 | Ricin B-like lectin EULS3/EULS3 | Response to drought stress. May play a role in ABA-induced stomatal closure | Van Hove et al. 2015 |
FIR094 | F: CAAAAGCCTCTCACTCTTGAGC R: TCAAACCCAAACAAAACGAA | CT | 199–215 | Probable inactive receptor kinase At2g26730/At2g26730 | Functional kinase activity, described as a putative gene expressed in drought treatment | Silveira et al. 2015 |
GOT004 | F: GGGCATATTGATCGCTTAGG R:TGAGCATTCATACATTCCATT | TG | 290 | Probable aquaporin TIP1-1/TIP1-1 | Induced by water stress, salt stress and exogenous ABA. May be involved in transport of water and small neutral solutes across cell membranes in roots and leaves | Liu et al. 1994 |
GOT021 | F: AGAAAGTTCCAGGGAAAGCA R: CTTCGTCCCCAGTTGAATGT | AT | 113 | Histidine kinase SHK278 N/A | Response to environmental stimuli such as water deficit. Involved in the control of water use efficiency as an important part of a signalling cascade to effect stomatal closure | |
GOT045 | F: TCAACAAAACCCATTAAACCAA R: GGATCGGAGTGAAATGGAGA | CT complex | 141 | Probable E3 ubiquitin-protein ligase ARI8/ARI8 | Induced by abiotic stresses such as drought stress (involved). May play combinatory roles in control drought signalling pathways | Cho et al. 2008 |
VIT033 | F:AAACGACGGCCAGTCATGAAGAACAC R: TTCGGTGAACTTGAACTAGGC | (CTT)(CCT)CTT | 111 | Metallothionein 3b/MT3b | Induced by drought stress. Identified as drought-responsive in leaves and roots (confirmed as robust drought marker) | Cohen et al. 2010 |
VIT057 | F:AAACGACGGCCAGTTCAGCAAAATCCCA R: ACACTTCGCTGTTCCTCGAT | AACTCG | 168 | Putative dehydration-responsive element binding protein N/A | TF. Induced by salt, dehydration and ABA stress (induced by dehydration and high-salt treatments) | Fang and Xiong 2015 |